Transcript: Human XM_011545268.3

PREDICTED: Homo sapiens transmembrane protein 134 (TMEM134), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM134 (80194)
Length:
1429
CDS:
81..509

Additional Resources:

NCBI RefSeq record:
XM_011545268.3
NBCI Gene record:
TMEM134 (80194)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545268.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243117 CCAACACCCTTTGATCCAGAA pLKO_005 416 CDS 100% 4.050 2.835 N TMEM134 n/a
2 TRCN0000243115 CCAGAACCTGGAGAACGATGA pLKO_005 251 CDS 100% 4.050 2.835 N TMEM134 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545268.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04185 pDONR223 100% 77.1% 75.5% None (many diffs) n/a
2 ccsbBroad304_04185 pLX_304 0% 77.1% 75.5% V5 (many diffs) n/a
3 TRCN0000468213 AACTTCGCGGTGAGAGAAACTACG pLX_317 82.2% 77.1% 75.5% V5 (many diffs) n/a
Download CSV