Transcript: Human XM_011545528.2

PREDICTED: Homo sapiens NHS actin remodeling regulator (NHS), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NHS (4810)
Length:
8373
CDS:
836..4843

Additional Resources:

NCBI RefSeq record:
XM_011545528.2
NBCI Gene record:
NHS (4810)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545528.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082895 CCAAATGATTTGGATGGTAAA pLKO.1 3731 CDS 100% 10.800 15.120 N NHS n/a
2 TRCN0000082894 CCGAGTGATGACTCCATCATT pLKO.1 4118 CDS 100% 0.563 0.788 N NHS n/a
3 TRCN0000421382 ACCTTGAACTTCCAATTATAC pLKO_005 3120 CDS 100% 13.200 9.240 N NHS n/a
4 TRCN0000422592 AGCAGTCTTCTAGATTCAAAT pLKO_005 3602 CDS 100% 13.200 9.240 N NHS n/a
5 TRCN0000416668 CTTTAGCATAGTTTGATTTAC pLKO_005 5066 3UTR 100% 13.200 9.240 N NHS n/a
6 TRCN0000412956 TAGACATTCTTGATTAGTTTC pLKO_005 5011 3UTR 100% 10.800 7.560 N NHS n/a
7 TRCN0000082893 CCAGGTTCTTAAACTAACAAA pLKO.1 5912 3UTR 100% 5.625 3.938 N NHS n/a
8 TRCN0000082897 GCCCAAATGATTTGGATGGTA pLKO.1 3729 CDS 100% 3.000 2.100 N NHS n/a
9 TRCN0000082896 CCTCAGTTAGATGCTTCGGAT pLKO.1 2660 CDS 100% 2.640 1.848 N NHS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545528.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.