Transcript: Human XM_011545751.2

PREDICTED: Homo sapiens GSG1 like (GSG1L), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GSG1L (146395)
Length:
1109
CDS:
80..937

Additional Resources:

NCBI RefSeq record:
XM_011545751.2
NBCI Gene record:
GSG1L (146395)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545751.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242694 GCGAGGAGGACTTTCACTTAG pLKO_005 762 CDS 100% 10.800 7.560 N GSG1L n/a
2 TRCN0000242697 TCTCCGAGGTGCTGTACATTC pLKO_005 498 CDS 100% 10.800 7.560 N GSG1L n/a
3 TRCN0000242695 CAATGTCATCGACGGGCTCAA pLKO_005 571 CDS 100% 4.050 2.835 N GSG1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545751.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04989 pDONR223 100% 31.1% 26.6% None (many diffs) n/a
2 ccsbBroad304_04989 pLX_304 0% 31.1% 26.6% V5 (many diffs) n/a
Download CSV