Transcript: Human XM_011545850.2

PREDICTED: Homo sapiens integrin subunit alpha M (ITGAM), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ITGAM (3684)
Length:
4518
CDS:
81..3356

Additional Resources:

NCBI RefSeq record:
XM_011545850.2
NBCI Gene record:
ITGAM (3684)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545850.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029049 CCGGATTCACTTTACCTTCAA pLKO.1 482 CDS 100% 4.950 6.930 N ITGAM n/a
2 TRCN0000029051 CCTCTCGTTTGACTGGTACAT pLKO.1 3047 CDS 100% 4.950 6.930 N ITGAM n/a
3 TRCN0000029053 GTCACCTTTAATATCACGTTT pLKO.1 2526 CDS 100% 4.950 6.930 N ITGAM n/a
4 TRCN0000439053 AGCGCTGCCATCACCTCTAAT pLKO_005 960 CDS 100% 13.200 10.560 N ITGAM n/a
5 TRCN0000414619 CAACTGTGATGGAGCAATTAA pLKO_005 415 CDS 100% 15.000 10.500 N ITGAM n/a
6 TRCN0000423490 GAAACTACAGTTGCCGAATTG pLKO_005 2039 CDS 100% 10.800 7.560 N ITGAM n/a
7 TRCN0000029050 CGTCTTCAATGAGACAAAGAA pLKO.1 1964 CDS 100% 5.625 3.938 N ITGAM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545850.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06463 pDONR223 100% 92.8% 93% None (many diffs) n/a
2 ccsbBroad304_06463 pLX_304 0% 92.8% 93% V5 (many diffs) n/a
Download CSV