Transcript: Human XM_011545985.2

PREDICTED: Homo sapiens TAO kinase 2 (TAOK2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TAOK2 (9344)
Length:
4677
CDS:
817..3984

Additional Resources:

NCBI RefSeq record:
XM_011545985.2
NBCI Gene record:
TAOK2 (9344)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001162271 GCCAGGGTTAGTGAAGCTAG pXPR_003 GGG 499 16% 7 0.6151 TAOK2 TAOK2 77252
2 BRDN0001148565 TCAAGACAGACCAACCTCAG pXPR_003 AGG 814 26% 10 0.4644 TAOK2 TAOK2 77249
3 BRDN0001162486 CCCAACACCATTCAGTACCG pXPR_003 GGG 272 9% 4 0.4458 TAOK2 TAOK2 77250
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545985.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233517 GTCTGAGTACTTCCGGAATTT pLKO_005 1566 CDS 100% 13.200 18.480 N TAOK2 n/a
2 TRCN0000001443 CCACCGCTCTTTAACATGAAT pLKO.1 1483 CDS 100% 5.625 7.875 N TAOK2 n/a
3 TRCN0000001932 CCACCGCTCTTTAACATGAAT pLKO.1 1483 CDS 100% 5.625 7.875 N TAOK2 n/a
4 TRCN0000001935 TACCACATTGCACAGAACGAA pLKO.1 1519 CDS 100% 0.000 0.000 N TAOK2 n/a
5 TRCN0000196622 GAGATGTGCGTGTCAAATATT pLKO.1 4248 3UTR 100% 15.000 10.500 N TAOK2 n/a
6 TRCN0000233519 TGGGTCTAGACATACTATATT pLKO_005 4297 3UTR 100% 15.000 10.500 N TAOK2 n/a
7 TRCN0000238791 ACGGAAACCACCGCTCTTTAA pLKO_005 1476 CDS 100% 13.200 9.240 N TAOK2 n/a
8 TRCN0000001445 CACCTCTCACAGCTCCATTAT pLKO.1 2061 CDS 100% 13.200 9.240 N TAOK2 n/a
9 TRCN0000001934 CACCTCTCACAGCTCCATTAT pLKO.1 2061 CDS 100% 13.200 9.240 N TAOK2 n/a
10 TRCN0000233518 CCGGGCTCTGACAACCTATAT pLKO_005 2092 CDS 100% 13.200 9.240 N TAOK2 n/a
11 TRCN0000233516 TTCTCTGACCTCCGGGAAATT pLKO_005 898 CDS 100% 13.200 9.240 N TAOK2 n/a
12 TRCN0000001446 ACTCCCACAACATGATCCATA pLKO.1 1244 CDS 100% 4.950 3.465 N TAOK2 n/a
13 TRCN0000001933 ACTCCCACAACATGATCCATA pLKO.1 1244 CDS 100% 4.950 3.465 N TAOK2 n/a
14 TRCN0000195585 CCTTCTAGAAGTGCACAAGAA pLKO.1 1158 CDS 100% 4.950 3.465 N TAOK2 n/a
15 TRCN0000001444 GCTTGGCTGGTAATGGAGTAT pLKO.1 1117 CDS 100% 4.950 3.465 N TAOK2 n/a
16 TRCN0000001936 GCTTGGCTGGTAATGGAGTAT pLKO.1 1117 CDS 100% 4.950 3.465 N TAOK2 n/a
17 TRCN0000195627 CCATCAAGAAGATGTCCTACA pLKO.1 980 CDS 100% 4.050 2.835 N TAOK2 n/a
18 TRCN0000199630 GCCCTGCTGCTGCTAAGAAAC pLKO.1 3817 CDS 100% 3.600 2.520 N TAOK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545985.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.