Transcript: Human XM_011546181.2

PREDICTED: Homo sapiens cytokine receptor like factor 2 (CRLF2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CRLF2 (64109)
Length:
1700
CDS:
128..1240

Additional Resources:

NCBI RefSeq record:
XM_011546181.2
NBCI Gene record:
CRLF2 (64109)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011546181.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059179 GCGAGACGACATTCTCTATTT pLKO.1 394 CDS 100% 13.200 18.480 N CRLF2 n/a
2 TRCN0000434746 CAAGTCGCTGGATGGTTTATT pLKO_005 450 CDS 100% 15.000 10.500 N CRLF2 n/a
3 TRCN0000420840 CAATTGCTCCAGGAGATTTAC pLKO_005 1467 3UTR 100% 13.200 9.240 N CRLF2 n/a
4 TRCN0000059180 CCTTCTGTCTTTATGGAAATT pLKO.1 865 CDS 100% 13.200 9.240 N CRLF2 n/a
5 TRCN0000425368 TCAGGATCCACGTTGACATTT pLKO_005 1267 3UTR 100% 13.200 9.240 N CRLF2 n/a
6 TRCN0000059178 CCCAAACCAAAGCTGTCCAAA pLKO.1 797 CDS 100% 4.950 3.465 N CRLF2 n/a
7 TRCN0000059181 CCTGACTTTCCACTACAGATT pLKO.1 289 CDS 100% 4.950 3.465 N CRLF2 n/a
8 TRCN0000059182 GTCACCATAGAAGGCTTGGAT pLKO.1 632 CDS 100% 3.000 2.100 N CRLF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011546181.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.