Transcript: Human XM_017000332.1

PREDICTED: Homo sapiens collagen type IX alpha 2 chain (COL9A2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COL9A2 (1298)
Length:
2889
CDS:
113..2194

Additional Resources:

NCBI RefSeq record:
XM_017000332.1
NBCI Gene record:
COL9A2 (1298)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000332.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412464 GACCAATGACTGAGGTCTATG pLKO_005 2602 3UTR 100% 10.800 15.120 N COL9A2 n/a
2 TRCN0000422795 TGAGGCGGCTATACCCTTAAG pLKO_005 2685 3UTR 100% 10.800 15.120 N COL9A2 n/a
3 TRCN0000083692 CCCGGGATTGATGGTTTAACT pLKO.1 350 CDS 100% 5.625 7.875 N COL9A2 n/a
4 TRCN0000423878 GTAGAGCACTGATGGGTGAAA pLKO_005 2363 3UTR 100% 4.950 6.930 N COL9A2 n/a
5 TRCN0000083688 GCCTCCCAGCTCAGTATTTAA pLKO.1 2729 3UTR 100% 15.000 10.500 N COL9A2 n/a
6 TRCN0000430443 TCTGGAAGGCAGTGCGGATTT pLKO_005 607 CDS 100% 10.800 7.560 N COL9A2 n/a
7 TRCN0000418271 CCTCCCTGGTGAGATTGGAAT pLKO_005 496 CDS 100% 4.950 3.465 N COL9A2 n/a
8 TRCN0000431148 TGCTCGCTCTGGCGCAGATTA pLKO_005 168 CDS 100% 4.400 3.080 N COL9A2 n/a
9 TRCN0000083689 CCCTCATGGATATAAAGGCAT pLKO.1 865 CDS 100% 2.640 1.848 N COL9A2 n/a
10 TRCN0000083690 CCAGGCATCAACGGCAAGGAT pLKO.1 1031 CDS 100% 1.000 0.700 N COL9A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000332.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.