Transcript: Human XM_017000533.2

PREDICTED: Homo sapiens multiple EGF like domains 6 (MEGF6), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MEGF6 (1953)
Length:
7605
CDS:
359..5038

Additional Resources:

NCBI RefSeq record:
XM_017000533.2
NBCI Gene record:
MEGF6 (1953)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000533.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055519 GCAGGCATTGTGTCCGTAGAA pLKO.1 1260 CDS 100% 4.950 3.465 N MEGF6 n/a
2 TRCN0000055520 GCTGCCAGAGAGCCTGTGATA pLKO.1 2976 CDS 100% 1.650 1.155 N MEGF6 n/a
3 TRCN0000055521 GCTGCCTGTGATGCCGTGAAT pLKO.1 3308 CDS 100% 1.650 1.155 N MEGF6 n/a
4 TRCN0000055522 CCTGTGAAGATGTGGACGAAT pLKO.1 1389 CDS 100% 4.950 2.970 N MEGF6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000533.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.