Transcript: Human XM_017000691.1

PREDICTED: Homo sapiens pleckstrin homology domain containing A6 (PLEKHA6), transcript variant X23, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLEKHA6 (22874)
Length:
10112
CDS:
3112..6177

Additional Resources:

NCBI RefSeq record:
XM_017000691.1
NBCI Gene record:
PLEKHA6 (22874)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000691.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426981 TCATCCCTGAACGGTACATTG pLKO_005 5804 CDS 100% 10.800 15.120 N PLEKHA6 n/a
2 TRCN0000183301 GCCAATTTGATTTGCTAGTAT pLKO.1 9771 3UTR 100% 5.625 7.875 N PLEKHA6 n/a
3 TRCN0000184725 CCAGCATTATGACGTGGACAT pLKO.1 5751 CDS 100% 4.050 5.670 N PLEKHA6 n/a
4 TRCN0000130333 GCCTTCTCAATGAGCACATTA pLKO.1 9463 3UTR 100% 13.200 9.240 N PLEKHA6 n/a
5 TRCN0000440588 AGAAAGAGCCTCCGGTGAAAG pLKO_005 3341 CDS 100% 10.800 7.560 N PLEKHA6 n/a
6 TRCN0000428301 CAAACAGCACCATAGAGTATG pLKO_005 4709 CDS 100% 10.800 7.560 N PLEKHA6 n/a
7 TRCN0000148834 CTCAATTTGGACACCCAGAAT pLKO.1 4780 CDS 100% 4.950 3.465 N PLEKHA6 n/a
8 TRCN0000149638 GAGAGGATCAAGACACTCATT pLKO.1 5884 CDS 100% 4.950 3.465 N PLEKHA6 n/a
9 TRCN0000148854 CCACACCTACAAGTTAAACGA pLKO.1 4437 CDS 100% 3.000 2.100 N PLEKHA6 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 9724 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000691.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.