Transcript: Human XM_017000777.1

PREDICTED: Homo sapiens calmodulin binding transcription activator 1 (CAMTA1), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CAMTA1 (23261)
Length:
7938
CDS:
72..4754

Additional Resources:

NCBI RefSeq record:
XM_017000777.1
NBCI Gene record:
CAMTA1 (23261)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000777.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158023 CACAAGTGTAACAGCGCCAAA pLKO.1 897 CDS 100% 4.050 5.670 N CAMTA1 n/a
2 TRCN0000438066 CCAGACAGCTTTCCGGAAATA pLKO_005 4325 CDS 100% 13.200 9.240 N CAMTA1 n/a
3 TRCN0000156461 CCCTAAGACAAGACCACAGAA pLKO.1 362 CDS 100% 4.950 3.465 N CAMTA1 n/a
4 TRCN0000150891 GAATGGCTCAATGATACTCTA pLKO.1 380 CDS 100% 4.950 3.465 N CAMTA1 n/a
5 TRCN0000151227 GCTGTGATTGTACAACAGAAA pLKO.1 4590 CDS 100% 4.950 3.465 N CAMTA1 n/a
6 TRCN0000153603 CCCTTCTTCTAATACCAGCTT pLKO.1 4127 CDS 100% 2.640 1.848 N CAMTA1 n/a
7 TRCN0000150628 GCCAAGTAATGTGAATGCTAA pLKO.1 6217 3UTR 100% 4.950 2.970 N CAMTA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000777.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.