Transcript: Human XM_017000819.1

PREDICTED: Homo sapiens SZT2 subunit of KICSTOR complex (SZT2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SZT2 (23334)
Length:
10972
CDS:
83..10291

Additional Resources:

NCBI RefSeq record:
XM_017000819.1
NBCI Gene record:
SZT2 (23334)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000819.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129938 GATTATCGAATCTCCCGAAAT pLKO.1 212 CDS 100% 10.800 15.120 N SZT2 n/a
2 TRCN0000148359 CTATGTAACTATCCAGGCCTA pLKO.1 592 CDS 100% 2.160 3.024 N SZT2 n/a
3 TRCN0000430175 AGTTGGACCTTAGCCCATCTA pLKO_005 441 CDS 100% 4.950 3.960 N SZT2 n/a
4 TRCN0000439062 GGGCAGGTGTTCCTGTTAATG pLKO_005 185 CDS 100% 13.200 9.240 N SZT2 n/a
5 TRCN0000263292 GACTCAGACCACCTAGGTTAT pLKO_005 5579 CDS 100% 10.800 7.560 N SZT2 n/a
6 TRCN0000263289 GTGCTATGTCCGTGGGCTATT pLKO_005 4051 CDS 100% 10.800 7.560 N SZT2 n/a
7 TRCN0000263288 TGAGCTTTGAATACCTGATAC pLKO_005 2997 CDS 100% 10.800 7.560 N SZT2 n/a
8 TRCN0000183364 GACTTGGACATCTACTTGTAT pLKO.1 6815 CDS 100% 5.625 3.938 N SZT2 n/a
9 TRCN0000149568 GTTTGTCATTGAGTTGGACCT pLKO.1 430 CDS 100% 2.160 1.512 N SZT2 n/a
10 TRCN0000263291 GCACCCAGGACTATCCAATTT pLKO_005 5170 CDS 100% 13.200 7.920 N SZT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000819.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.