Transcript: Human XM_017000837.1

PREDICTED: Homo sapiens ubiquitin specific peptidase 24 (USP24), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP24 (23358)
Length:
4421
CDS:
262..4299

Additional Resources:

NCBI RefSeq record:
XM_017000837.1
NBCI Gene record:
USP24 (23358)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000837.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245776 ACAATACTGTGACCGTATAAA pLKO_005 1620 CDS 100% 15.000 21.000 N USP24 n/a
2 TRCN0000245777 TACACTTACCGGGAGTATTTA pLKO_005 2425 CDS 100% 15.000 21.000 N USP24 n/a
3 TRCN0000245779 CTCTCGTATGTAACGTATTTG pLKO_005 3551 CDS 100% 13.200 18.480 N USP24 n/a
4 TRCN0000245778 GAGCGCTATGTGATCACTATA pLKO_005 3115 CDS 100% 13.200 9.240 N USP24 n/a
5 TRCN0000040630 CCTCATTTCATGGACATCTTT pLKO.1 3179 CDS 100% 5.625 3.938 N Usp24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000837.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.