Transcript: Human XM_017001323.2

PREDICTED: Homo sapiens tripartite motif containing 67 (TRIM67), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRIM67 (440730)
Length:
3494
CDS:
580..3144

Additional Resources:

NCBI RefSeq record:
XM_017001323.2
NBCI Gene record:
TRIM67 (440730)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001323.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150956 GATGCTTTAACTCGTCAGAAA pLKO.1 1774 CDS 100% 4.950 6.930 N TRIM67 n/a
2 TRCN0000150770 GCCTTAAATGGAGTTTCAGAT pLKO.1 1639 CDS 100% 4.950 3.465 N TRIM67 n/a
3 TRCN0000150728 GCTAAAGAACATATTGCAGCA pLKO.1 1692 CDS 100% 2.160 1.512 N TRIM67 n/a
4 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3402 3UTR 100% 4.950 2.475 Y ERAP2 n/a
5 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3403 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001323.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.