Transcript: Human XM_017001361.1

PREDICTED: Homo sapiens ATPase Na+/K+ transporting subunit alpha 1 (ATP1A1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATP1A1 (476)
Length:
6302
CDS:
2994..5972

Additional Resources:

NCBI RefSeq record:
XM_017001361.1
NBCI Gene record:
ATP1A1 (476)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001361.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432331 GTGAATTTCCCTATCGATAAT pLKO_005 4626 CDS 100% 13.200 18.480 N ATP1A1 n/a
2 TRCN0000425443 ATACCTTAACCAGTAACATTC pLKO_005 5233 CDS 100% 10.800 15.120 N ATP1A1 n/a
3 TRCN0000043223 CCAGTTGTCTATTCATAAGAA pLKO.1 4364 CDS 100% 5.625 7.875 N ATP1A1 n/a
4 TRCN0000437385 CACGGTCTGTCTGACACTTAC pLKO_005 3920 CDS 100% 10.800 8.640 N ATP1A1 n/a
5 TRCN0000043227 CGGCAGTGATCTAAAGGACAT pLKO.1 4898 CDS 100% 4.050 3.240 N ATP1A1 n/a
6 TRCN0000444902 GACGTCCTGGAATGAAGCATG pLKO_005 6107 3UTR 100% 4.050 3.240 N ATP1A1 n/a
7 TRCN0000043225 GCCTTGATGAACTTCATCGTA pLKO.1 3040 CDS 100% 3.000 2.400 N ATP1A1 n/a
8 TRCN0000043224 CCCGTTCCTGATATTTATTAT pLKO.1 5264 CDS 100% 15.000 10.500 N ATP1A1 n/a
9 TRCN0000414765 GCCTTTCAGAACGCCTATTTG pLKO_005 4509 CDS 100% 13.200 9.240 N ATP1A1 n/a
10 TRCN0000432457 GGTGCTATCAGCCGTTGTAAT pLKO_005 3302 CDS 100% 13.200 9.240 N ATP1A1 n/a
11 TRCN0000311572 CAAGCCCTTGTGATTCGAAAT pLKO_005 3402 CDS 100% 10.800 7.560 N Atp1a1 n/a
12 TRCN0000429060 CAAGCCCTTGTGATTCGAAAT pLKO_005 3402 CDS 100% 10.800 7.560 N ATP1A1 n/a
13 TRCN0000101880 CGTCCTGGAATGAAGCATGTA pLKO.1 6109 3UTR 100% 4.950 3.465 N Atp1a1 n/a
14 TRCN0000332624 CGTCCTGGAATGAAGCATGTA pLKO_005 6109 3UTR 100% 4.950 3.465 N Atp1a1 n/a
15 TRCN0000430334 GTGTACTTCAGTCTTGGAGTT pLKO_005 6039 3UTR 100% 4.050 2.835 N ATP1A1 n/a
16 TRCN0000043226 CCTGCTGACCTCAGAATCATA pLKO.1 3498 CDS 100% 5.625 3.375 N ATP1A1 n/a
17 TRCN0000424769 GAACTCTACCCTGGTAGGAAA pLKO_005 6062 3UTR 100% 4.950 2.970 N ATP1A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001361.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.