Transcript: Human XM_017001391.1

PREDICTED: Homo sapiens platelet activating factor acetylhydrolase 2 (PAFAH2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PAFAH2 (5051)
Length:
3385
CDS:
345..1160

Additional Resources:

NCBI RefSeq record:
XM_017001391.1
NBCI Gene record:
PAFAH2 (5051)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001391.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294478 TCAGCGGCAACCACCTATTTC pLKO_005 399 CDS 100% 13.200 18.480 N PAFAH2 n/a
2 TRCN0000048813 CGAGTGTTTACGGGTGTTGAA pLKO.1 551 CDS 100% 4.950 6.930 N PAFAH2 n/a
3 TRCN0000307218 CGAGTGTTTACGGGTGTTGAA pLKO_005 551 CDS 100% 4.950 6.930 N PAFAH2 n/a
4 TRCN0000048816 GCATGAACAGTCTAGGATCAT pLKO.1 881 CDS 100% 4.950 3.960 N PAFAH2 n/a
5 TRCN0000048815 GCCGAGTACCTGCAGTTTAAT pLKO.1 265 5UTR 100% 15.000 10.500 N PAFAH2 n/a
6 TRCN0000048814 CGACCTGAAAGAAGACTATAA pLKO.1 1064 CDS 100% 13.200 9.240 N PAFAH2 n/a
7 TRCN0000290573 CGACCTGAAAGAAGACTATAA pLKO_005 1064 CDS 100% 13.200 9.240 N PAFAH2 n/a
8 TRCN0000294477 CTTGGATAACTGGGTACTTTG pLKO_005 1296 3UTR 100% 10.800 7.560 N PAFAH2 n/a
9 TRCN0000048817 GATGTGATGGAGGGTCAGAAT pLKO.1 142 5UTR 100% 4.950 3.465 N PAFAH2 n/a
10 TRCN0000290633 GATGTGATGGAGGGTCAGAAT pLKO_005 142 5UTR 100% 4.950 3.465 N PAFAH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001391.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.