Transcript: Human XM_017001788.1

PREDICTED: Homo sapiens ASH1 like histone lysine methyltransferase (ASH1L), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ASH1L (55870)
Length:
6267
CDS:
136..3870

Additional Resources:

NCBI RefSeq record:
XM_017001788.1
NBCI Gene record:
ASH1L (55870)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001788.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246167 GAGTCGATTGATCCAATTAAA pLKO_005 990 CDS 100% 15.000 21.000 N ASH1L n/a
2 TRCN0000246169 ATCCCGTCGGTTCTATCATAA pLKO_005 3156 CDS 100% 13.200 18.480 N ASH1L n/a
3 TRCN0000016171 CGACGATGTTATTCGCTGTAT pLKO.1 2706 CDS 100% 4.950 6.930 N ASH1L n/a
4 TRCN0000016172 CGTACTTTGTTTATCCCAGAA pLKO.1 3832 CDS 100% 4.050 5.670 N ASH1L n/a
5 TRCN0000358486 CTTCACCTTAAGGGTTAATAA pLKO_005 4094 3UTR 100% 15.000 12.000 N ASH1L n/a
6 TRCN0000246170 CGGTAGTTCTTGCAATTATTT pLKO_005 4537 3UTR 100% 15.000 10.500 N ASH1L n/a
7 TRCN0000358528 AGATCCTCACTGGTTACTATA pLKO_005 2456 CDS 100% 13.200 9.240 N ASH1L n/a
8 TRCN0000246168 CGTCTACGAAAGGCCTATTAC pLKO_005 2572 CDS 100% 13.200 9.240 N ASH1L n/a
9 TRCN0000082300 CCCATTCATGTTGGAAAGTAT pLKO.1 1066 CDS 100% 5.625 3.938 N Ash1l n/a
10 TRCN0000246171 GATGATTGAGCAGTATCATAA pLKO_005 1521 CDS 100% 1.320 0.792 N ASH1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001788.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.