Transcript: Human XM_017001851.2

PREDICTED: Homo sapiens OTU deubiquitinase 7B (OTUD7B), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OTUD7B (56957)
Length:
6298
CDS:
629..2773

Additional Resources:

NCBI RefSeq record:
XM_017001851.2
NBCI Gene record:
OTUD7B (56957)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001851.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368310 AGTTCTGAGGAGCCTGTATAT pLKO_005 1094 CDS 100% 13.200 18.480 N OTUD7B n/a
2 TRCN0000004534 CCTGTATATGAGAGCCTTGAA pLKO.1 1106 CDS 100% 4.950 6.930 N OTUD7B n/a
3 TRCN0000355677 CAAAGTTAAGCTCAACTAATT pLKO_005 2807 3UTR 100% 13.200 10.560 N OTUD7B n/a
4 TRCN0000355678 ACCGAGTGGCTGATTCCTATA pLKO_005 2547 CDS 100% 10.800 8.640 N OTUD7B n/a
5 TRCN0000230694 TAACGGAGGGAGCAAGTATAG pLKO_005 1987 CDS 100% 10.800 8.640 N OTUD7B n/a
6 TRCN0000230695 TGGAAATGCTCACGGTTTATA pLKO_005 4574 3UTR 100% 15.000 10.500 N OTUD7B n/a
7 TRCN0000230692 TCTGTCCCTAGAGGTCAAATT pLKO_005 1486 CDS 100% 13.200 9.240 N OTUD7B n/a
8 TRCN0000230693 CAGATTCTGTGGCTAACAAAC pLKO_005 1737 CDS 100% 10.800 7.560 N OTUD7B n/a
9 TRCN0000004533 GCAAGGAGGCTAAACAAAGTT pLKO.1 2793 3UTR 100% 5.625 3.938 N OTUD7B n/a
10 TRCN0000004532 CCCAACTCAGACCAAATGCAA pLKO.1 2629 CDS 100% 3.000 2.100 N OTUD7B n/a
11 TRCN0000004531 CGGTCCCATGTCTCCTCCAAT pLKO.1 572 5UTR 100% 1.650 1.155 N OTUD7B n/a
12 TRCN0000004530 CGGGACTTGATGCTGCGGAAA pLKO.1 866 CDS 100% 1.350 0.945 N OTUD7B n/a
13 TRCN0000218377 TTGAAGAGTTTCACGTCTTTG pLKO_005 1122 CDS 100% 10.800 6.480 N OTUD7B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001851.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.