Transcript: Human XM_017002003.2

PREDICTED: Homo sapiens regulator of G protein signaling 7 (RGS7), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RGS7 (6000)
Length:
2461
CDS:
427..1809

Additional Resources:

NCBI RefSeq record:
XM_017002003.2
NBCI Gene record:
RGS7 (6000)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002003.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014324 CGGAAGTCTGTCTATGGTTTA pLKO.1 1054 CDS 100% 10.800 8.640 N RGS7 n/a
2 TRCN0000418557 GCATGAGCAAAGGACCTAAAT pLKO_005 1965 3UTR 100% 13.200 9.240 N RGS7 n/a
3 TRCN0000414540 TCCGCACAGAAAGTTTCATTT pLKO_005 2290 3UTR 100% 13.200 9.240 N RGS7 n/a
4 TRCN0000014325 CCTGGACGATACACATTTGAA pLKO.1 1615 CDS 100% 5.625 3.938 N RGS7 n/a
5 TRCN0000014326 CCTCCAACAGAAGATGAGTTA pLKO.1 1129 CDS 100% 4.950 3.465 N RGS7 n/a
6 TRCN0000014323 GCACACACTTTGTAGCTCAAT pLKO.1 1906 3UTR 100% 4.950 3.465 N RGS7 n/a
7 TRCN0000014327 CCCAGTGCTATTAACTTGGAT pLKO.1 1555 CDS 100% 3.000 2.100 N RGS7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002003.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06863 pDONR223 100% 91.2% 90.3% None (many diffs) n/a
2 ccsbBroad304_06863 pLX_304 0% 91.2% 90.3% V5 (many diffs) n/a
Download CSV