Transcript: Human XM_017002089.2

PREDICTED: Homo sapiens SLIT-ROBO Rho GTPase activating protein 2B (SRGAP2B), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SRGAP2B (647135)
Length:
7099
CDS:
1210..2130

Additional Resources:

NCBI RefSeq record:
XM_017002089.2
NBCI Gene record:
SRGAP2B (647135)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002089.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370872 CATGACCTATCTGACCTTATT pLKO_005 1558 CDS 100% 13.200 6.600 Y SRGAP2 n/a
2 TRCN0000370810 ATAATATCATTCCTCGATTTG pLKO_005 1115 5UTR 100% 10.800 5.400 Y SRGAP2 n/a
3 TRCN0000352377 GCAAATTGGTAAATCGGTAAA pLKO_005 1320 CDS 100% 10.800 5.400 Y SRGAP2 n/a
4 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 5133 3UTR 100% 4.950 2.475 Y ORAI2 n/a
5 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 5372 3UTR 100% 4.950 2.475 Y ERAP2 n/a
6 TRCN0000281902 CATCTGTCTTCAAGTACTATA pLKO_005 1535 CDS 100% 13.200 6.600 Y Srgap2 n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5373 3UTR 100% 13.200 6.600 Y LIAS n/a
8 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 5130 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002089.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.