Transcript: Human XM_017002243.1

PREDICTED: Homo sapiens calcium voltage-gated channel subunit alpha1 E (CACNA1E), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CACNA1E (777)
Length:
17052
CDS:
426..7802

Additional Resources:

NCBI RefSeq record:
XM_017002243.1
NBCI Gene record:
CACNA1E (777)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002243.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044719 GCGTTCAAATTCCTCGTGGTT pLKO.1 6941 CDS 100% 2.640 3.696 N CACNA1E n/a
2 TRCN0000420590 AGGAACGTGGAGGGTTATTAC pLKO_005 8045 3UTR 100% 13.200 10.560 N CACNA1E n/a
3 TRCN0000044721 CCGCATCCATTACACTGAGAT pLKO.1 6131 CDS 100% 4.950 3.960 N CACNA1E n/a
4 TRCN0000044722 CCAGGATTTAAGGAGGACCAA pLKO.1 3794 CDS 100% 2.640 2.112 N CACNA1E n/a
5 TRCN0000417303 GTCCTTTGAGTACACCATTAT pLKO_005 5294 CDS 100% 13.200 9.240 N CACNA1E n/a
6 TRCN0000044718 CGCAACAAAGTCCTGAGGTAT pLKO.1 4404 CDS 100% 4.950 3.465 N CACNA1E n/a
7 TRCN0000044720 GCCGCCATTTGAGTACATGAT pLKO.1 1124 CDS 100% 4.950 3.465 N CACNA1E n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002243.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.