Transcript: Human XM_017002274.1

PREDICTED: Homo sapiens ecotropic viral integration site 5 (EVI5), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EVI5 (7813)
Length:
2864
CDS:
116..2776

Additional Resources:

NCBI RefSeq record:
XM_017002274.1
NBCI Gene record:
EVI5 (7813)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002274.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160367 CGGATAGTAAGTCTTTAAGAT pLKO.1 276 CDS 100% 5.625 7.875 N EVI5 n/a
2 TRCN0000162442 CGAGAAGAAGAGAGTCGTATT pLKO.1 2742 CDS 100% 10.800 8.640 N EVI5 n/a
3 TRCN0000162619 CGACAGACAAAGTTGCAGAAA pLKO.1 39 5UTR 100% 4.950 3.960 N EVI5 n/a
4 TRCN0000158645 CCCTTCCTGATGAGAATAATA pLKO.1 1734 CDS 100% 15.000 10.500 N EVI5 n/a
5 TRCN0000161333 GAGCAGAACAAGAGGTGATTA pLKO.1 2052 CDS 100% 13.200 9.240 N EVI5 n/a
6 TRCN0000160319 CTTTGTATGTACCAGTTTGAA pLKO.1 929 CDS 100% 5.625 3.938 N EVI5 n/a
7 TRCN0000088227 GAAGCCATTATGGGTTTGAAA pLKO.1 1802 CDS 100% 5.625 3.938 N Evi5 n/a
8 TRCN0000159452 GAGCAATAGTTTGGCAACTTT pLKO.1 570 CDS 100% 5.625 3.938 N EVI5 n/a
9 TRCN0000159840 GCAGAGATTGAATGCAAGAAT pLKO.1 2153 CDS 100% 5.625 3.938 N EVI5 n/a
10 TRCN0000161062 GCTGAGCTTGAAATCCAGAAA pLKO.1 2249 CDS 100% 4.950 3.465 N EVI5 n/a
11 TRCN0000161419 GAATGGGAAGATGTACGCAAA pLKO.1 413 CDS 100% 4.050 2.835 N EVI5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002274.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.