Transcript: Human XM_017002504.1

PREDICTED: Homo sapiens leucine rich repeat containing 8 VRAC subunit C (LRRC8C), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRRC8C (84230)
Length:
6961
CDS:
89..2410

Additional Resources:

NCBI RefSeq record:
XM_017002504.1
NBCI Gene record:
LRRC8C (84230)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002504.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436162 ACCGTTCTCTACGGGAATATT pLKO_005 1026 CDS 100% 15.000 21.000 N LRRC8C n/a
2 TRCN0000167683 GCTCTCTAAGTCATGATATTT pLKO.1 1566 CDS 100% 15.000 21.000 N LRRC8C n/a
3 TRCN0000168217 CCTATGCAACAAGATCCGATA pLKO.1 2038 CDS 100% 4.050 5.670 N LRRC8C n/a
4 TRCN0000172348 CGATTACCTCTCAGTAGCCAT pLKO.1 172 CDS 100% 2.640 2.112 N LRRC8C n/a
5 TRCN0000419053 CCTACATCCCAGAGCATATAA pLKO_005 1947 CDS 100% 15.000 10.500 N LRRC8C n/a
6 TRCN0000168665 GCTACAGACAAATGCCCATAA pLKO.1 1249 CDS 100% 10.800 7.560 N LRRC8C n/a
7 TRCN0000417764 AGATCGCGTAAGGAGTATGTA pLKO_005 2526 3UTR 100% 5.625 3.938 N LRRC8C n/a
8 TRCN0000167027 CTGAGAAGTTTGTAGTTGATA pLKO.1 648 CDS 100% 5.625 3.938 N LRRC8C n/a
9 TRCN0000173039 CCACCTCTTCCTATGCAACAA pLKO.1 2029 CDS 100% 4.950 3.465 N LRRC8C n/a
10 TRCN0000168104 CCCTCTCTATTCCAAGAGATT pLKO.1 1141 CDS 100% 0.495 0.347 N LRRC8C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002504.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.