Transcript: Human XM_017003166.2

PREDICTED: Homo sapiens ubiquitin conjugating enzyme E2 E3 (UBE2E3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBE2E3 (10477)
Length:
3355
CDS:
398..793

Additional Resources:

NCBI RefSeq record:
XM_017003166.2
NBCI Gene record:
UBE2E3 (10477)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003166.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221009 CCCTTGATCCTCCTCCTAATT pLKO.1 618 CDS 100% 13.200 6.600 Y UBE2E4P n/a
2 TRCN0000221011 CTGAAGAACAAGAGGAAAGAA pLKO.1 492 CDS 100% 5.625 2.813 Y UBE2E4P n/a
3 TRCN0000007577 CCACTGCTAAGTTATCCACTA pLKO.1 561 CDS 100% 4.050 2.025 Y UBE2E3 n/a
4 TRCN0000318678 CCACTGCTAAGTTATCCACTA pLKO_005 561 CDS 100% 4.050 2.025 Y UBE2E3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003166.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02448 pDONR223 100% 54.6% 40.6% None (many diffs) n/a
2 ccsbBroad304_02448 pLX_304 0% 54.6% 40.6% V5 (many diffs) n/a
Download CSV