Transcript: Human XM_017003279.1

PREDICTED: Homo sapiens nitric oxide synthase trafficking (NOSTRIN), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NOSTRIN (115677)
Length:
2108
CDS:
566..2023

Additional Resources:

NCBI RefSeq record:
XM_017003279.1
NBCI Gene record:
NOSTRIN (115677)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003279.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045588 CCGACTTATCAAGTCCTAAAT pLKO.1 629 CDS 100% 13.200 18.480 N NOSTRIN n/a
2 TRCN0000174077 CCGACTTATCAAGTCCTAAAT pLKO.1 629 CDS 100% 13.200 18.480 N NOSTRIN n/a
3 TRCN0000045590 GCCGCTTATGTGGAGGAGTTA pLKO.1 1967 CDS 100% 4.950 3.960 N NOSTRIN n/a
4 TRCN0000045589 GCAACTGGAATCAGCAAATTA pLKO.1 714 CDS 100% 15.000 10.500 N NOSTRIN n/a
5 TRCN0000045591 GCGTTAATGGATGAGAACAAT pLKO.1 1541 CDS 100% 5.625 3.938 N NOSTRIN n/a
6 TRCN0000045592 GCATACTCATAGCTATGTGAA pLKO.1 1684 CDS 100% 4.950 3.465 N NOSTRIN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003279.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.