Transcript: Human XM_017003734.1

PREDICTED: Homo sapiens R3H domain containing 1 (R3HDM1), transcript variant X32, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
R3HDM1 (23518)
Length:
5094
CDS:
1352..4117

Additional Resources:

NCBI RefSeq record:
XM_017003734.1
NBCI Gene record:
R3HDM1 (23518)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003734.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080919 CGCCAGATATTTAGAGTTAAT pLKO.1 1691 CDS 100% 13.200 18.480 N R3hdm1 n/a
2 TRCN0000324818 CGCCAGATATTTAGAGTTAAT pLKO_005 1691 CDS 100% 13.200 18.480 N R3hdm1 n/a
3 TRCN0000380007 TGGGAAGTCTGTCATAGTAAA pLKO_005 1236 5UTR 100% 13.200 18.480 N R3HDM1 n/a
4 TRCN0000296862 AGACTTTCAGAAACGTTATAT pLKO_005 1456 CDS 100% 15.000 10.500 N R3HDM1 n/a
5 TRCN0000331090 GAGAGCCAGAGACCGAATATT pLKO_005 1585 CDS 100% 15.000 10.500 N R3HDM1 n/a
6 TRCN0000381343 GCCAACCCTGAACGCTCTAAA pLKO_005 3932 CDS 100% 13.200 9.240 N R3HDM1 n/a
7 TRCN0000082692 CAGATGAGAATACGTTTGAAA pLKO.1 1517 CDS 100% 5.625 3.938 N R3HDM1 n/a
8 TRCN0000291108 CAGATGAGAATACGTTTGAAA pLKO_005 1517 CDS 100% 5.625 3.938 N R3HDM1 n/a
9 TRCN0000082688 GCCTCTTAAACCACTTACATT pLKO.1 4749 3UTR 100% 5.625 3.938 N R3HDM1 n/a
10 TRCN0000291166 GCCTCTTAAACCACTTACATT pLKO_005 4749 3UTR 100% 5.625 3.938 N R3HDM1 n/a
11 TRCN0000082691 CAGTGATAAGTTGCCCAGAAA pLKO.1 963 5UTR 100% 4.950 3.465 N R3HDM1 n/a
12 TRCN0000082689 CCAACCCAACAGCATTGGAAA pLKO.1 2950 CDS 100% 4.950 3.465 N R3HDM1 n/a
13 TRCN0000082690 CCAGTGATAAGTTGCCCAGAA pLKO.1 962 5UTR 100% 4.050 2.835 N R3HDM1 n/a
14 TRCN0000291109 CCAGTGATAAGTTGCCCAGAA pLKO_005 962 5UTR 100% 4.050 2.835 N R3HDM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003734.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.