Transcript: Human XM_017003848.1

PREDICTED: Homo sapiens SH2 domain containing 6 (SH2D6), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SH2D6 (284948)
Length:
5342
CDS:
4187..5137

Additional Resources:

NCBI RefSeq record:
XM_017003848.1
NBCI Gene record:
SH2D6 (284948)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003848.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437415 AGGTGTCTGCCCAGTTCACTA pLKO_005 5156 3UTR 100% 4.950 3.465 N SH2D6 n/a
2 TRCN0000156781 GAAACTCGGAATGGAACAGCA pLKO.1 4769 CDS 100% 2.640 1.848 N SH2D6 n/a
3 TRCN0000156885 GAAATCGTCTCTTCCCTCTGT pLKO.1 4810 CDS 100% 2.640 1.848 N SH2D6 n/a
4 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 20 5UTR 100% 1.080 0.540 Y GPR83 n/a
5 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 20 5UTR 100% 1.080 0.540 Y MYORG n/a
6 TRCN0000156830 GCAGATGCTGCCTCTAAAGAA pLKO.1 4787 CDS 100% 5.625 3.375 N SH2D6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003848.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.