Transcript: Human XM_017004333.1

PREDICTED: Homo sapiens BAF chromatin remodeling complex subunit BCL11A (BCL11A), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BCL11A (53335)
Length:
5714
CDS:
3..2504

Additional Resources:

NCBI RefSeq record:
XM_017004333.1
NBCI Gene record:
BCL11A (53335)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004333.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000448972 ACAGAACACTCATGGATTAAG pLKO_005 563 CDS 100% 13.200 18.480 N Bcl11a n/a
2 TRCN0000033453 GCATAGACGATGGCACTGTTA pLKO.1 1783 CDS 100% 4.950 6.930 N BCL11A n/a
3 TRCN0000033452 GCGGTTGAATCCAATGGCTAT pLKO.1 899 CDS 100% 4.050 5.670 N BCL11A n/a
4 TRCN0000096551 CCGCAGGGTATTTGTAAAGAT pLKO.1 471 CDS 100% 5.625 4.500 N Bcl11a n/a
5 TRCN0000033449 CGCACAGAACACTCATGGATT pLKO.1 560 CDS 100% 4.950 3.960 N BCL11A n/a
6 TRCN0000359207 ACCTCTCCATGGGATTCATAT pLKO_005 671 CDS 100% 13.200 9.240 N BCL11A n/a
7 TRCN0000033451 CCAGAGGATGACGATTGTTTA pLKO.1 315 CDS 100% 13.200 9.240 N BCL11A n/a
8 TRCN0000096550 GCCAGAGGATGACGATTGTTT pLKO.1 314 CDS 100% 5.625 3.938 N Bcl11a n/a
9 TRCN0000096553 CACAAACGGAAACAATGCAAT pLKO.1 192 CDS 100% 4.950 3.465 N Bcl11a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004333.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.