Transcript: Human XM_017004425.2

PREDICTED: Homo sapiens replication timing regulatory factor 1 (RIF1), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RIF1 (55183)
Length:
9837
CDS:
510..7811

Additional Resources:

NCBI RefSeq record:
XM_017004425.2
NBCI Gene record:
RIF1 (55183)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004425.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158124 CCGTGTTTAGGAGACTCGAAA pLKO.1 5982 CDS 100% 4.950 6.930 N RIF1 n/a
2 TRCN0000154859 GCTCTATTGTTAGGTCCCATT pLKO.1 7060 CDS 100% 4.050 5.670 N RIF1 n/a
3 TRCN0000155897 CCACCTGGTTTGCTTAATCAA pLKO.1 4374 CDS 100% 5.625 4.500 N RIF1 n/a
4 TRCN0000220017 TCTTATGAGACGTATAGTATT pLKO.1 8465 3UTR 100% 13.200 9.240 N RIF1 n/a
5 TRCN0000220016 TTTCAACTTCTGGCGGTTAAA pLKO.1 8364 3UTR 100% 13.200 9.240 N RIF1 n/a
6 TRCN0000155431 CGCATTCTGCTGTTGTTGATT pLKO.1 967 CDS 100% 5.625 3.938 N RIF1 n/a
7 TRCN0000155442 GCCTGATGAAGCTGAAACAAA pLKO.1 6542 CDS 100% 5.625 3.938 N RIF1 n/a
8 TRCN0000155531 GCAGCCAAACTGAAACTTGAA pLKO.1 3459 CDS 100% 4.950 3.465 N RIF1 n/a
9 TRCN0000155022 GCTATCTGGAAGGAGCTAATT pLKO.1 1914 CDS 100% 13.200 7.920 N RIF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004425.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.