Transcript: Human XM_017004577.2

PREDICTED: Homo sapiens ubiquitin specific peptidase 37 (USP37), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP37 (57695)
Length:
5769
CDS:
1018..3213

Additional Resources:

NCBI RefSeq record:
XM_017004577.2
NBCI Gene record:
USP37 (57695)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004577.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416702 TCACATCCGTAGCTGATTATC pLKO_005 3402 3UTR 100% 13.200 18.480 N USP37 n/a
2 TRCN0000419728 TCCGGGTAGAGGATCGATTAA pLKO_005 866 5UTR 100% 13.200 18.480 N USP37 n/a
3 TRCN0000423373 GCGAAACAAAGCCGCCTAATG pLKO_005 570 5UTR 100% 10.800 15.120 N USP37 n/a
4 TRCN0000412978 CCACTCCCTCCTCGTTCAATT pLKO_005 1816 CDS 100% 13.200 9.240 N USP37 n/a
5 TRCN0000004568 CCGGATTTGCAGAAGATGATA pLKO.1 2486 CDS 100% 5.625 3.938 N USP37 n/a
6 TRCN0000010890 CGGAGTGGCTACATCTTCTTT pLKO.1 3094 CDS 100% 5.625 3.938 N USP37 n/a
7 TRCN0000004567 GAGAATAAAGTCAGCCTAGTA pLKO.1 468 5UTR 100% 4.950 3.465 N USP37 n/a
8 TRCN0000004570 GCTACCGAGTTAAGTCTTCAA pLKO.1 2779 CDS 100% 4.950 3.465 N USP37 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004577.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.