Transcript: Human XM_017004669.1

PREDICTED: Homo sapiens sodium voltage-gated channel alpha subunit 9 (SCN9A), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SCN9A (6335)
Length:
5441
CDS:
146..5368

Additional Resources:

NCBI RefSeq record:
XM_017004669.1
NBCI Gene record:
SCN9A (6335)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004669.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424746 TCGTTGTGAATGCACTCATAG pLKO_005 3327 CDS 100% 10.800 15.120 N SCN9A n/a
2 TRCN0000426857 TTAAGGGATGGACGATTATTA pLKO_005 3615 CDS 100% 15.000 10.500 N SCN9A n/a
3 TRCN0000044506 CGGCTGAATATACAAGTATTA pLKO.1 732 CDS 100% 13.200 9.240 N SCN9A n/a
4 TRCN0000433360 GAATCCTACGTCTAGTCAAAG pLKO_005 4257 CDS 100% 10.800 7.560 N SCN9A n/a
5 TRCN0000044507 CCTTCCAAAGTGTCCTATGAA pLKO.1 5015 CDS 100% 5.625 3.938 N SCN9A n/a
6 TRCN0000044504 CCCTTATGAATGTTAGTCAAA pLKO.1 3516 CDS 100% 4.950 3.465 N SCN9A n/a
7 TRCN0000044505 GCTGATTTGATTGAAACGTAT pLKO.1 4187 CDS 100% 4.950 3.465 N SCN9A n/a
8 TRCN0000173720 CTTCGTTCACAGATGGAAGAA pLKO.1 4976 CDS 100% 4.950 2.970 N Scn9a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004669.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.