Transcript: Human XM_017004710.2

PREDICTED: Homo sapiens anaphase promoting complex subunit 1 (ANAPC1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANAPC1 (64682)
Length:
6856
CDS:
280..6045

Additional Resources:

NCBI RefSeq record:
XM_017004710.2
NBCI Gene record:
ANAPC1 (64682)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004710.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163532 GCTCCAGTTACGCTGTGTAAA pLKO.1 1626 CDS 100% 13.200 18.480 N ANAPC1 n/a
2 TRCN0000330750 GCTCCAGTTACGCTGTGTAAA pLKO_005 1626 CDS 100% 13.200 18.480 N ANAPC1 n/a
3 TRCN0000163891 CCGTGCTCAGAGGATTTGAAT pLKO.1 4630 CDS 100% 5.625 4.500 N ANAPC1 n/a
4 TRCN0000330678 CATGAACATGATGGGTTATAA pLKO_005 2271 CDS 100% 15.000 10.500 N ANAPC1 n/a
5 TRCN0000162224 CCAGAGAACCTTTACCTACTA pLKO.1 887 CDS 100% 4.950 3.465 N ANAPC1 n/a
6 TRCN0000330676 CCAGAGAACCTTTACCTACTA pLKO_005 887 CDS 100% 4.950 3.465 N ANAPC1 n/a
7 TRCN0000330677 TCCATGGTTAGGATCACTATT pLKO_005 2086 CDS 100% 13.200 7.920 N ANAPC1 n/a
8 TRCN0000159074 GCAAAGCTCATGTATTAACAT pLKO.1 741 CDS 100% 5.625 2.813 Y ANAPC1 n/a
9 TRCN0000167787 GCTTTGGCTATGATCTACTTA pLKO.1 4399 CDS 100% 5.625 2.813 Y LOC285074 n/a
10 TRCN0000161529 GCAGACTTGTAGTCTTGAGTA pLKO.1 2888 CDS 100% 4.950 2.475 Y ANAPC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004710.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.