Transcript: Human XM_017004724.2

PREDICTED: Homo sapiens poly(A) polymerase gamma (PAPOLG), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PAPOLG (64895)
Length:
3574
CDS:
834..2264

Additional Resources:

NCBI RefSeq record:
XM_017004724.2
NBCI Gene record:
PAPOLG (64895)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004724.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229404 ACTACTTGAGCCACCGAATTT pLKO_005 1196 CDS 100% 13.200 18.480 N PAPOLG n/a
2 TRCN0000250311 GTCTGGGATCCTCGGGTAAAT pLKO_005 1011 CDS 100% 13.200 18.480 N Papolg n/a
3 TRCN0000218873 CTATGCCTATTCCAACTATTG pLKO_005 2128 CDS 100% 10.800 15.120 N PAPOLG n/a
4 TRCN0000053222 CCTCGGGTAAATCCATCAGAT pLKO.1 1020 CDS 100% 4.950 6.930 N PAPOLG n/a
5 TRCN0000053219 CGCATCTGAATGGAATGTCAA pLKO.1 2005 CDS 100% 4.950 3.960 N PAPOLG n/a
6 TRCN0000229405 ATGTGGTTCCTTGGGATAATT pLKO_005 1422 CDS 100% 15.000 10.500 N PAPOLG n/a
7 TRCN0000250315 ATGTGGTTCCTTGGGATAATT pLKO_005 1422 CDS 100% 15.000 10.500 N Papolg n/a
8 TRCN0000229407 TAAGAGTTGGGCACCATAAAT pLKO_005 2937 3UTR 100% 15.000 10.500 N PAPOLG n/a
9 TRCN0000053220 CCACATCAACTCGAACAGTAA pLKO.1 1105 CDS 100% 4.950 3.465 N PAPOLG n/a
10 TRCN0000053221 CCTTCTGTTGTGGCTACTGTT pLKO.1 487 5UTR 100% 4.950 3.465 N PAPOLG n/a
11 TRCN0000174172 CCTTCTGTTGTGGCTACTGTT pLKO.1 487 5UTR 100% 4.950 3.465 N PAPOLG n/a
12 TRCN0000053218 CCCAGTAAAGAACTACCAGAT pLKO.1 2172 CDS 100% 4.050 2.835 N PAPOLG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004724.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03982 pDONR223 100% 64.6% 64.6% None 0_1ins714;1274_1275ins66 n/a
2 ccsbBroad304_03982 pLX_304 0% 64.6% 64.6% V5 0_1ins714;1274_1275ins66 n/a
Download CSV