Transcript: Human XM_017004964.1

PREDICTED: Homo sapiens calcium responsive transcription factor (CARF), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CARF (79800)
Length:
5102
CDS:
229..2100

Additional Resources:

NCBI RefSeq record:
XM_017004964.1
NBCI Gene record:
CARF (79800)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004964.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151951 CCAGCTCGGATTTACATTAAA pLKO.1 868 CDS 100% 15.000 21.000 N CARF n/a
2 TRCN0000265727 GAGACCATTTGTGGGTATATT pLKO_005 3613 3UTR 100% 15.000 21.000 N CARF n/a
3 TRCN0000256029 GTGTTGCACTATAGGTAATAT pLKO_005 4134 3UTR 100% 15.000 21.000 N CARF n/a
4 TRCN0000256023 TATATGGGCCTGCCGTCTTAG pLKO_005 534 CDS 100% 10.800 15.120 N CARF n/a
5 TRCN0000156177 CCCTCACGTTTACATCCTCAA pLKO.1 1162 CDS 100% 4.050 5.670 N CARF n/a
6 TRCN0000150380 CCAAGTTAAACAAGAACCCAA pLKO.1 2016 CDS 100% 2.640 3.696 N CARF n/a
7 TRCN0000265737 TGGACAGGTACTTCGTGTAAT pLKO_005 255 CDS 100% 13.200 10.560 N CARF n/a
8 TRCN0000151354 GTCTTAGAAAGGAAGGTGAAT pLKO.1 2145 3UTR 100% 4.950 3.960 N CARF n/a
9 TRCN0000256028 GAAATGGAGATACGGTATATA pLKO_005 1373 CDS 100% 15.000 10.500 N CARF n/a
10 TRCN0000256022 GGAATGGCACAAGTGATTATA pLKO_005 292 CDS 100% 15.000 10.500 N CARF n/a
11 TRCN0000256025 ACCAGCTGTGGTATCAGTAAA pLKO_005 1653 CDS 100% 13.200 9.240 N CARF n/a
12 TRCN0000150753 GAGACCATGACAGTTACATTT pLKO.1 1453 CDS 100% 13.200 9.240 N CARF n/a
13 TRCN0000256024 TTAGAAAGTGTCCTAACATTT pLKO_005 610 CDS 100% 13.200 9.240 N CARF n/a
14 TRCN0000150616 GAAACCCAGTAACAGAAACTT pLKO.1 363 CDS 100% 5.625 3.938 N CARF n/a
15 TRCN0000151436 GCAGACTATTCCAATACAGAT pLKO.1 1938 CDS 100% 4.950 3.465 N CARF n/a
16 TRCN0000150930 GCAGGCTATTCAATATGAACT pLKO.1 43 5UTR 100% 4.950 3.465 N CARF n/a
17 TRCN0000152252 CATTTGTTAATGCAGGGAGTA pLKO.1 740 CDS 100% 4.050 2.835 N CARF n/a
18 TRCN0000256026 GTACCTGAAAGACATAATTTA pLKO_005 1291 CDS 100% 0.000 0.000 N CARF n/a
19 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 3436 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004964.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.