Transcript: Human XM_017005122.2

PREDICTED: Homo sapiens plakophilin 4 (PKP4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PKP4 (8502)
Length:
5187
CDS:
860..4435

Additional Resources:

NCBI RefSeq record:
XM_017005122.2
NBCI Gene record:
PKP4 (8502)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005122.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123181 GCCAACGAAGTACCCTTACAT pLKO.1 2229 CDS 100% 5.625 7.875 N PKP4 n/a
2 TRCN0000290198 GCCAACGAAGTACCCTTACAT pLKO_005 2229 CDS 100% 5.625 7.875 N PKP4 n/a
3 TRCN0000123362 CCAGCCACCTATGCAGTATTA pLKO.1 4051 CDS 100% 13.200 10.560 N Pkp4 n/a
4 TRCN0000123179 CCCAAGGAACTGTGAGCAATT pLKO.1 4993 3UTR 100% 10.800 7.560 N PKP4 n/a
5 TRCN0000290200 CCCAAGGAACTGTGAGCAATT pLKO_005 4993 3UTR 100% 10.800 7.560 N PKP4 n/a
6 TRCN0000123183 GACTTGCACATTACTCCTATA pLKO.1 2081 CDS 100% 10.800 7.560 N PKP4 n/a
7 TRCN0000290199 GACTTGCACATTACTCCTATA pLKO_005 2081 CDS 100% 10.800 7.560 N PKP4 n/a
8 TRCN0000123363 GCAGAAGTAAGGGAGCTTGTT pLKO.1 2741 CDS 100% 4.950 3.465 N Pkp4 n/a
9 TRCN0000318017 GCAGAAGTAAGGGAGCTTGTT pLKO_005 2741 CDS 100% 4.950 3.465 N Pkp4 n/a
10 TRCN0000123180 CGACCTTCTTATAGAGCAGAA pLKO.1 4382 CDS 100% 4.050 2.835 N PKP4 n/a
11 TRCN0000290201 CGACCTTCTTATAGAGCAGAA pLKO_005 4382 CDS 100% 4.050 2.835 N PKP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005122.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.