Transcript: Human XM_017005494.1

PREDICTED: Homo sapiens ATP binding cassette subfamily C member 5 (ABCC5), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABCC5 (10057)
Length:
1971
CDS:
164..790

Additional Resources:

NCBI RefSeq record:
XM_017005494.1
NBCI Gene record:
ABCC5 (10057)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005494.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060306 CCCAAGGGAAAGTACCATCAT pLKO.1 392 CDS 100% 4.950 3.960 N ABCC5 n/a
2 TRCN0000111043 GCTGTATTCTGCGGTCAGAAT pLKO.1 768 CDS 100% 0.495 0.347 N Abcc5 n/a
3 TRCN0000111042 CGAAGGGTTGTGTGGATCTTT pLKO.1 665 CDS 100% 5.625 4.500 N Abcc5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005494.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.