Transcript: Human XM_017005519.1

PREDICTED: Homo sapiens CTD small phosphatase like (CTDSPL), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CTDSPL (10217)
Length:
3520
CDS:
49..942

Additional Resources:

NCBI RefSeq record:
XM_017005519.1
NBCI Gene record:
CTDSPL (10217)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005519.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220116 GCACAGTTCGTTTAAGCCTAT pLKO.1 402 CDS 100% 4.050 5.670 N CTDSPL n/a
2 TRCN0000314819 GCACAGTTCGTTTAAGCCTAT pLKO_005 402 CDS 100% 4.050 5.670 N CTDSPL n/a
3 TRCN0000220117 CCCTTGAATCTGCTTTATGTA pLKO.1 2303 3UTR 100% 5.625 4.500 N CTDSPL n/a
4 TRCN0000220115 TGACGGTGCTTGACTATGGAA pLKO.1 344 CDS 100% 3.000 2.400 N CTDSPL n/a
5 TRCN0000314818 TGACGGTGCTTGACTATGGAA pLKO_005 344 CDS 100% 3.000 2.400 N CTDSPL n/a
6 TRCN0000220119 CCAGTGCAACGTCAGCTTAAA pLKO.1 132 CDS 100% 13.200 9.240 N CTDSPL n/a
7 TRCN0000314820 CTTCTGCTGCTTCCGTGATTA pLKO_005 186 CDS 100% 13.200 9.240 N CTDSPL n/a
8 TRCN0000382179 GAAATGTGTGGTCATTGATTT pLKO_005 366 CDS 100% 13.200 9.240 N CTDSPL n/a
9 TRCN0000314821 AGCTGAGCAAAGTGATCATTG pLKO_005 689 CDS 100% 10.800 7.560 N CTDSPL n/a
10 TRCN0000380141 TGCTGCACAGACTCTGCAATA pLKO_005 854 CDS 100% 10.800 7.560 N CTDSPL n/a
11 TRCN0000220118 CCTGCCTCATACATCTTCCAT pLKO.1 721 CDS 100% 3.000 2.100 N CTDSPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005519.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.