Transcript: Human XM_017005639.1

PREDICTED: Homo sapiens adenylate cyclase 5 (ADCY5), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADCY5 (111)
Length:
5090
CDS:
16..2778

Additional Resources:

NCBI RefSeq record:
XM_017005639.1
NBCI Gene record:
ADCY5 (111)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005639.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438216 AGCAGGTAGACGACCGATTTG pLKO_005 1181 CDS 100% 10.800 15.120 N ADCY5 n/a
2 TRCN0000078338 CGCCATAGACTTCTTCAACAA pLKO.1 1812 CDS 100% 4.950 6.930 N ADCY5 n/a
3 TRCN0000078339 GCCGCAGAGAATCACTGTTTA pLKO.1 430 CDS 100% 13.200 10.560 N ADCY5 n/a
4 TRCN0000078342 CAACGCCATAGACTTCTTCAA pLKO.1 1809 CDS 100% 4.950 3.960 N ADCY5 n/a
5 TRCN0000078340 GCTACACTCAACTACCTGAAT pLKO.1 742 CDS 100% 4.950 3.960 N ADCY5 n/a
6 TRCN0000431693 TTGTCTCCAATGTTCTCATTT pLKO_005 53 CDS 100% 13.200 9.240 N ADCY5 n/a
7 TRCN0000078341 TCTGTGATCTACTCCTGCGTA pLKO.1 1336 CDS 100% 2.640 1.848 N ADCY5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005639.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.