Transcript: Human XM_017006036.1

PREDICTED: Homo sapiens DnaJ heat shock protein family (Hsp40) member C13 (DNAJC13), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNAJC13 (23317)
Length:
6004
CDS:
554..5254

Additional Resources:

NCBI RefSeq record:
XM_017006036.1
NBCI Gene record:
DNAJC13 (23317)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006036.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243948 ACTTGCATACTGCGATGTTTA pLKO_005 316 5UTR 100% 13.200 18.480 N DNAJC13 n/a
2 TRCN0000243951 AGTCGCCTTGGAGGGTATTTG pLKO_005 3281 CDS 100% 13.200 18.480 N DNAJC13 n/a
3 TRCN0000243950 GATCCTAATTGTATCACATTA pLKO_005 5409 3UTR 100% 13.200 9.240 N DNAJC13 n/a
4 TRCN0000243947 TAGGTCCAAAGGTTCGAATTA pLKO_005 4185 CDS 100% 13.200 9.240 N DNAJC13 n/a
5 TRCN0000146708 CACGAGAAGAACTGAAAGATA pLKO.1 861 CDS 100% 5.625 3.938 N DNAJC13 n/a
6 TRCN0000181204 CGCCTTTATCTGAGTGGAGTA pLKO.1 1874 CDS 100% 4.050 2.835 N DNAJC13 n/a
7 TRCN0000112226 CCACCCTGATAAGAATCCAAA pLKO.1 2515 CDS 100% 4.950 3.465 N Dnaja1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006036.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.