Transcript: Human XM_017006167.1

PREDICTED: Homo sapiens forkhead box P1 (FOXP1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FOXP1 (27086)
Length:
2333
CDS:
259..2292

Additional Resources:

NCBI RefSeq record:
XM_017006167.1
NBCI Gene record:
FOXP1 (27086)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006167.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015663 CGCAGAAGTTAGACCACCATT pLKO.1 1641 CDS 100% 4.950 6.930 N FOXP1 n/a
2 TRCN0000015664 GCAGCAAGTTAGTGGATTAAA pLKO.1 489 CDS 100% 15.000 10.500 N FOXP1 n/a
3 TRCN0000244819 GCAGCAAGTTAGTGGATTAAA pLKO_005 489 CDS 100% 15.000 10.500 N FOXP1 n/a
4 TRCN0000321629 GCAGCAAGTTAGTGGATTAAA pLKO_005 489 CDS 100% 15.000 10.500 N Foxp1 n/a
5 TRCN0000244822 TGGTAACCCTTCCCTTATTAA pLKO_005 1908 CDS 100% 15.000 10.500 N FOXP1 n/a
6 TRCN0000321565 TGGTAACCCTTCCCTTATTAA pLKO_005 1908 CDS 100% 15.000 10.500 N Foxp1 n/a
7 TRCN0000244821 AGCCCAATGTAGAGTACAAAT pLKO_005 1275 CDS 100% 13.200 9.240 N FOXP1 n/a
8 TRCN0000244820 TGCGAAGATTTCCAATCATTT pLKO_005 1210 CDS 100% 13.200 9.240 N FOXP1 n/a
9 TRCN0000015666 GTGCGAAGATTTCCAATCATT pLKO.1 1209 CDS 100% 5.625 3.938 N FOXP1 n/a
10 TRCN0000015667 CAGGCTTCAATGGCTGAGAAT pLKO.1 1978 CDS 100% 4.950 3.465 N FOXP1 n/a
11 TRCN0000072006 GCTTACCTCATACTCCAACAA pLKO.1 1466 CDS 100% 4.950 3.960 N Foxp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006167.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.