Transcript: Human XM_017006308.2

PREDICTED: Homo sapiens NME/NM23 family member 9 (NME9), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NME9 (347736)
Length:
10048
CDS:
2036..3061

Additional Resources:

NCBI RefSeq record:
XM_017006308.2
NBCI Gene record:
NME9 (347736)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359570 TGTACCTTGGCCATCATTAAA pLKO_005 2513 CDS 100% 15.000 21.000 N NME9 n/a
2 TRCN0000064178 CGGCACAGAAATGCCCTTCAA pLKO.1 2842 CDS 100% 4.950 3.960 N NME9 n/a
3 TRCN0000064179 CTGGGTTTGAAATTCTAACAA pLKO.1 2589 CDS 100% 5.625 3.938 N NME9 n/a
4 TRCN0000064180 GCATTTGAGAAGCTGGTACAT pLKO.1 2675 CDS 100% 4.950 3.465 N NME9 n/a
5 TRCN0000064181 GATCGTCTTGATGTCCTCGAA pLKO.1 2240 CDS 100% 2.640 1.848 N NME9 n/a
6 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 4985 3UTR 100% 4.950 2.475 Y CFLAR n/a
7 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 4985 3UTR 100% 4.950 2.475 Y C19orf31 n/a
8 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 5063 3UTR 100% 4.950 2.475 Y ORAI2 n/a
9 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 5060 3UTR 100% 4.950 2.475 Y LOC339059 n/a
10 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 4983 3UTR 100% 4.950 2.475 Y ERN2 n/a
11 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 4983 3UTR 100% 4.950 2.475 Y P3H4 n/a
12 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 4983 3UTR 100% 4.950 2.475 Y P3H4 n/a
13 TRCN0000165205 GCCTCAGTTTCCTCATCTGTA pLKO.1 4438 3UTR 100% 4.950 2.475 Y YIF1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.