Transcript: Human XM_017006330.1

PREDICTED: Homo sapiens nicotinamide nucleotide adenylyltransferase 3 (NMNAT3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NMNAT3 (349565)
Length:
2323
CDS:
464..1504

Additional Resources:

NCBI RefSeq record:
XM_017006330.1
NBCI Gene record:
NMNAT3 (349565)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006330.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428929 GATTTGACAGGATGCTAATTA pLKO_005 1933 3UTR 100% 15.000 21.000 N NMNAT3 n/a
2 TRCN0000035401 TCTCCTGTCAACGACACCTAT pLKO.1 884 CDS 100% 4.950 6.930 N NMNAT3 n/a
3 TRCN0000433975 GACAAGGAGGTCTACTTATTT pLKO_005 1776 3UTR 100% 15.000 10.500 N NMNAT3 n/a
4 TRCN0000035400 CAGGAAATAGTGGAGAAGTTT pLKO.1 1205 CDS 100% 5.625 3.938 N NMNAT3 n/a
5 TRCN0000035403 CGATGCTGTCATCACGTACAT pLKO.1 1405 CDS 100% 4.950 3.465 N NMNAT3 n/a
6 TRCN0000035402 GAATGAGATCAGTGCCACATA pLKO.1 1336 CDS 100% 4.950 3.465 N NMNAT3 n/a
7 TRCN0000428128 GAAGAAAGACCTCGCAGCTTC pLKO_005 907 CDS 100% 4.050 2.835 N NMNAT3 n/a
8 TRCN0000035399 GCAGAGCGTAAAGTACCTGAT pLKO.1 1381 CDS 100% 4.050 2.835 N NMNAT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006330.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05519 pDONR223 100% 62.1% 62.1% None 1_393del n/a
2 ccsbBroad304_05519 pLX_304 0% 62.1% 62.1% V5 1_393del n/a
Download CSV