Transcript: Human XM_017006562.1

PREDICTED: Homo sapiens zinc finger DHHC-type containing 3 (ZDHHC3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZDHHC3 (51304)
Length:
4067
CDS:
275..1327

Additional Resources:

NCBI RefSeq record:
XM_017006562.1
NBCI Gene record:
ZDHHC3 (51304)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006562.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160237 CATCGAGAGTTTACAGTTGAA pLKO.1 616 CDS 100% 4.950 6.930 N ZDHHC3 n/a
2 TRCN0000137338 CGAAACATTGAGCGGAAACCA pLKO.1 302 CDS 100% 3.000 2.400 N ZDHHC3 n/a
3 TRCN0000120664 CCCAAAGGAAATGCCACTAAA pLKO.1 590 CDS 100% 13.200 9.240 N Zdhhc3 n/a
4 TRCN0000162755 CCCAAAGGAAATGCCACTAAA pLKO.1 590 CDS 100% 13.200 9.240 N ZDHHC3 n/a
5 TRCN0000345219 CCCAAAGGAAATGCCACTAAA pLKO_005 590 CDS 100% 13.200 9.240 N Zdhhc3 n/a
6 TRCN0000164379 CCAGAAGTACTTCGTCCTGTT pLKO.1 778 CDS 100% 4.050 2.835 N ZDHHC3 n/a
7 TRCN0000159818 GCTTTGAAGAAGATTGGACAA pLKO.1 864 CDS 100% 4.050 2.835 N ZDHHC3 n/a
8 TRCN0000133710 GTATAGCATCATCAACGGAAT pLKO.1 496 CDS 100% 4.050 2.835 N ZDHHC3 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2480 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006562.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.