Transcript: Human XM_017006627.1

PREDICTED: Homo sapiens plastin 1 (PLS1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLS1 (5357)
Length:
3835
CDS:
289..2178

Additional Resources:

NCBI RefSeq record:
XM_017006627.1
NBCI Gene record:
PLS1 (5357)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006627.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369954 TGCCTGCACAAGCCGAATAAT pLKO_005 1417 CDS 100% 15.000 21.000 N PLS1 n/a
2 TRCN0000344829 TCGTATTAGACAAGACTAAAT pLKO_005 2447 3UTR 100% 13.200 18.480 N PLS1 n/a
3 TRCN0000056205 CCATGTCAACAAACCTCCTTA pLKO.1 1611 CDS 100% 4.950 6.930 N PLS1 n/a
4 TRCN0000056206 CGCCATTTCAGTTGCTCGAAA pLKO.1 2046 CDS 100% 4.950 6.930 N PLS1 n/a
5 TRCN0000056204 CCTAGATTTAATAGATGCCAT pLKO.1 1947 CDS 100% 2.640 3.696 N PLS1 n/a
6 TRCN0000363755 CCTAGATTTAATAGATGCCAT pLKO_005 1947 CDS 100% 2.640 3.696 N PLS1 n/a
7 TRCN0000377407 AGCTCACGCCATTCACTATTT pLKO_005 845 CDS 100% 13.200 10.560 N PLS1 n/a
8 TRCN0000056203 CCCTGACTGTAAGCATCTTAT pLKO.1 705 CDS 100% 13.200 10.560 N PLS1 n/a
9 TRCN0000363742 CCCTGACTGTAAGCATCTTAT pLKO_005 705 CDS 100% 13.200 10.560 N PLS1 n/a
10 TRCN0000056207 GACAGCAACAAAGATGGCAAA pLKO.1 478 CDS 100% 4.050 2.835 N PLS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006627.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.