Transcript: Human XM_017006885.2

PREDICTED: Homo sapiens kinesin family member 15 (KIF15), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIF15 (56992)
Length:
4824
CDS:
167..4285

Additional Resources:

NCBI RefSeq record:
XM_017006885.2
NBCI Gene record:
KIF15 (56992)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006885.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422062 CATAACCTGAGAGGAGTAATC pLKO_005 437 CDS 100% 10.800 15.120 N KIF15 n/a
2 TRCN0000113902 GCGTGACAAATGGTCAGTCTA pLKO.1 158 5UTR 100% 4.950 6.930 N KIF15 n/a
3 TRCN0000113904 GCTCTCTATACACTCAGAATT pLKO.1 2169 CDS 100% 0.000 0.000 N KIF15 n/a
4 TRCN0000113901 GCTGAATTTATGGACCTTAAT pLKO.1 4374 3UTR 100% 13.200 10.560 N KIF15 n/a
5 TRCN0000412917 CAAAGAGCCAAGCTGATTAAA pLKO_005 1121 CDS 100% 15.000 10.500 N KIF15 n/a
6 TRCN0000113903 CGTGACAAATGGTCAGTCTAA pLKO.1 159 5UTR 100% 4.950 3.465 N KIF15 n/a
7 TRCN0000113905 GCTGAAGTGAAGAGGCTCAAA pLKO.1 1193 CDS 100% 4.950 3.465 N KIF15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006885.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.