Transcript: Human XM_017006927.1

PREDICTED: Homo sapiens SUMO specific peptidase 7 (SENP7), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SENP7 (57337)
Length:
4634
CDS:
109..2964

Additional Resources:

NCBI RefSeq record:
XM_017006927.1
NBCI Gene record:
SENP7 (57337)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006927.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000320893 CCAAAGTACCGAGTCGAATAT pLKO_005 2559 CDS 100% 13.200 18.480 N SENP7 n/a
2 TRCN0000320820 GCTGACAGGTCACATCATATT pLKO_005 3366 3UTR 100% 13.200 18.480 N SENP7 n/a
3 TRCN0000004546 CGGTTGCTACTCCCTTTCTAT pLKO.1 1974 CDS 100% 5.625 7.875 N SENP7 n/a
4 TRCN0000004547 CCCAGAGTTATATTGACGAAT pLKO.1 298 CDS 100% 4.950 6.930 N SENP7 n/a
5 TRCN0000004545 GTCGAATATGTCAGTACCAAA pLKO.1 2571 CDS 100% 4.950 6.930 N SENP7 n/a
6 TRCN0000350289 ATCTGAATTATGCCCATATAA pLKO_005 1293 CDS 100% 15.000 10.500 N SENP7 n/a
7 TRCN0000004544 GCAGTGATTGTGGAGTATATT pLKO.1 2777 CDS 100% 15.000 10.500 N SENP7 n/a
8 TRCN0000320822 GTCATCTCTCTAGACCATAAA pLKO_005 220 CDS 100% 13.200 9.240 N SENP7 n/a
9 TRCN0000004543 AGTGCAGCTTATTATTCTCAA pLKO.1 3553 3UTR 100% 4.950 3.465 N SENP7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006927.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.