Transcript: Human XM_017006957.1

PREDICTED: Homo sapiens coiled-coil domain containing 191 (CCDC191), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC191 (57577)
Length:
4523
CDS:
950..3505

Additional Resources:

NCBI RefSeq record:
XM_017006957.1
NBCI Gene record:
CCDC191 (57577)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006957.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121703 CGTAGGAAGGTAGTTGAAATT pLKO.1 3392 CDS 100% 13.200 18.480 N CCDC191 n/a
2 TRCN0000427246 ATCGCTTAAGACGTGAGAAAG pLKO_005 1299 CDS 100% 10.800 15.120 N CCDC191 n/a
3 TRCN0000145061 CCAAAGGAACATTCTAGAGAT pLKO.1 3717 3UTR 100% 4.950 6.930 N CCDC191 n/a
4 TRCN0000143761 CTTCGTAGGAAGGTAGTTGAA pLKO.1 3389 CDS 100% 4.950 6.930 N CCDC191 n/a
5 TRCN0000439913 AGCTGCGGAGGGAGATAATTG pLKO_005 1458 CDS 100% 13.200 9.240 N CCDC191 n/a
6 TRCN0000433984 ATTCTTGATCATAGGATTAAG pLKO_005 1703 CDS 100% 13.200 9.240 N CCDC191 n/a
7 TRCN0000141049 CCACCTGCAACTGCTGAATAA pLKO.1 4181 3UTR 100% 13.200 9.240 N CCDC191 n/a
8 TRCN0000429865 GTTGCTGATGTGACCTTAATG pLKO_005 3847 3UTR 100% 13.200 9.240 N CCDC191 n/a
9 TRCN0000432658 ATTGCTAGTCATTCACTATAG pLKO_005 3675 3UTR 100% 10.800 7.560 N CCDC191 n/a
10 TRCN0000444531 GCTGGCTACAGTACGTGATTG pLKO_005 3144 CDS 100% 10.800 7.560 N CCDC191 n/a
11 TRCN0000145585 CGAGCTACTTCTTAGATCAAA pLKO.1 3609 3UTR 100% 5.625 3.938 N CCDC191 n/a
12 TRCN0000143350 GAAAGGGTCTTGCTAAGGAAA pLKO.1 2927 CDS 100% 4.950 3.465 N CCDC191 n/a
13 TRCN0000142498 GAGCTGGTCAATGACTGGTTA pLKO.1 971 CDS 100% 4.950 3.465 N CCDC191 n/a
14 TRCN0000142483 GCAACGAGACACTCAGAACTA pLKO.1 2292 CDS 100% 4.950 3.465 N CCDC191 n/a
15 TRCN0000142651 GTCAGGAAAGTCTGGCTAGAA pLKO.1 3066 CDS 100% 4.950 3.465 N CCDC191 n/a
16 TRCN0000143607 GAGTAAGACAAGTCTGGTGAA pLKO.1 3478 CDS 100% 4.050 2.835 N CCDC191 n/a
17 TRCN0000121684 GCTGAATAATACACTCAGTTT pLKO.1 4193 3UTR 100% 4.950 2.970 N CCDC191 n/a
18 TRCN0000143470 GAGATGAGACATAAGCAGGTA pLKO.1 1271 CDS 100% 2.640 1.584 N CCDC191 n/a
19 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 32 5UTR 100% 5.625 2.813 Y KLHL30 n/a
20 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 32 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006957.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.