Transcript: Human XM_017006962.1

PREDICTED: Homo sapiens protein tyrosine phosphatase receptor type G (PTPRG), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPRG (5793)
Length:
8694
CDS:
16..4392

Additional Resources:

NCBI RefSeq record:
XM_017006962.1
NBCI Gene record:
PTPRG (5793)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006962.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356041 AGCTAATACCACTCGAATATT pLKO_005 1380 CDS 100% 15.000 21.000 N PTPRG n/a
2 TRCN0000356040 ACGACATGCGCAGCGACTTTA pLKO_005 1340 CDS 100% 13.200 18.480 N PTPRG n/a
3 TRCN0000002864 GCATCCCATTCTCATTTGTTT pLKO.1 1505 CDS 100% 5.625 7.875 N PTPRG n/a
4 TRCN0000355985 TTACCTAGTTTGCACTATATG pLKO_005 4603 3UTR 100% 13.200 10.560 N PTPRG n/a
5 TRCN0000002861 CCACGACATGACAGACTTCTT pLKO.1 1035 CDS 100% 4.950 3.960 N PTPRG n/a
6 TRCN0000002863 GCCACATACTACGAAAGATTT pLKO.1 3735 CDS 100% 13.200 9.240 N PTPRG n/a
7 TRCN0000002862 CCAGATGACTTTGACAGCTTT pLKO.1 595 CDS 100% 4.950 3.465 N PTPRG n/a
8 TRCN0000002860 TAGGCACTGTTCAATACTGTA pLKO.1 4833 3UTR 100% 4.950 3.465 N PTPRG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006962.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.