Transcript: Human XM_017006994.1

PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ROBO2 (6092)
Length:
8643
CDS:
400..4737

Additional Resources:

NCBI RefSeq record:
XM_017006994.1
NBCI Gene record:
ROBO2 (6092)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006994.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240458 TCCGATGTCATCGTCTCTAAG pLKO_005 580 CDS 100% 10.800 15.120 N ROBO2 n/a
2 TRCN0000240456 CAGCCATTCGGTCCGTAATAA pLKO_005 2861 CDS 100% 15.000 10.500 N ROBO2 n/a
3 TRCN0000219865 CCTTCTTGACATAGGATATAT pLKO.1 4683 CDS 100% 15.000 10.500 N ROBO2 n/a
4 TRCN0000219866 TAGGCTGTGGTGCCATATATT pLKO.1 5111 3UTR 100% 15.000 10.500 N ROBO2 n/a
5 TRCN0000240457 CAGATAGACCTCCACCTATAA pLKO_005 1718 CDS 100% 13.200 9.240 N ROBO2 n/a
6 TRCN0000240455 CTGGTTAAAGGAGGGATTTAC pLKO_005 1830 CDS 100% 13.200 9.240 N ROBO2 n/a
7 TRCN0000240454 GGATAGAGCTGCATCACTTAA pLKO_005 5860 3UTR 100% 13.200 9.240 N ROBO2 n/a
8 TRCN0000148075 GAAGCTACAATAGCACAAGTA pLKO.1 2726 CDS 100% 4.950 3.465 N ROBO2 n/a
9 TRCN0000147712 GCTGTAGAATTTCGTTGTCAA pLKO.1 1189 CDS 100% 4.950 3.465 N ROBO2 n/a
10 TRCN0000147871 GTTACGTTTCAAAGAGGAGAT pLKO.1 3163 CDS 100% 4.050 2.835 N ROBO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006994.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.