Transcript: Human XM_017007182.1

PREDICTED: Homo sapiens queuine tRNA-ribosyltransferase accessory subunit 2 (QTRT2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
QTRT2 (79691)
Length:
3810
CDS:
483..1361

Additional Resources:

NCBI RefSeq record:
XM_017007182.1
NBCI Gene record:
QTRT2 (79691)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007182.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034702 CCGATGGAGAAGTATCTTGTA pLKO.1 547 CDS 100% 4.950 6.930 N QTRT2 n/a
2 TRCN0000034701 CCTGCTTATGATGCACAACTT pLKO.1 1244 CDS 100% 4.950 6.930 N QTRT2 n/a
3 TRCN0000034700 CCAAGGCTCATATCTGGTGTT pLKO.1 855 CDS 100% 4.050 3.240 N QTRT2 n/a
4 TRCN0000294093 GATATAAGGTCTGCTTAAATA pLKO_005 1467 3UTR 100% 15.000 10.500 N QTRT2 n/a
5 TRCN0000294092 TGAAGTCTTGACAGAATATAA pLKO_005 403 5UTR 100% 15.000 10.500 N QTRT2 n/a
6 TRCN0000306918 ACCCATCACACGCTGCATAAT pLKO_005 326 5UTR 100% 13.200 9.240 N QTRT2 n/a
7 TRCN0000294094 GGGACCACACCATGGATATTC pLKO_005 261 5UTR 100% 13.200 9.240 N QTRT2 n/a
8 TRCN0000034703 CCTGAAGAGACACTACTACAA pLKO.1 999 CDS 100% 4.950 3.465 N QTRT2 n/a
9 TRCN0000286821 CCTGAAGAGACACTACTACAA pLKO_005 999 CDS 100% 4.950 3.465 N QTRT2 n/a
10 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 2985 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007182.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08946 pDONR223 100% 70.3% 70.3% None 0_1ins369 n/a
2 ccsbBroad304_08946 pLX_304 0% 70.3% 70.3% V5 0_1ins369 n/a
Download CSV