Transcript: Human XM_017007431.1

PREDICTED: Homo sapiens kalirin RhoGEF kinase (KALRN), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KALRN (8997)
Length:
8398
CDS:
393..7589

Additional Resources:

NCBI RefSeq record:
XM_017007431.1
NBCI Gene record:
KALRN (8997)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007431.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234366 GCGGAAACTCGTGACGTATTT pLKO_005 620 CDS 100% 13.200 18.480 N KALRN n/a
2 TRCN0000048211 GCTCAGAATACGTACACCAAT pLKO.1 2157 CDS 100% 4.950 6.930 N KALRN n/a
3 TRCN0000048208 CCCGGAAGAAAGAATTTATTA pLKO.1 4234 CDS 100% 15.000 10.500 N KALRN n/a
4 TRCN0000234368 CTTCAGGACACACGAAATATG pLKO_005 4939 CDS 100% 13.200 9.240 N KALRN n/a
5 TRCN0000234369 TGATTCAAGAAAGGATCATTC pLKO_005 5131 CDS 100% 10.800 7.560 N KALRN n/a
6 TRCN0000001430 CAAAGATTACTATGCACTGAA pLKO.1 7379 CDS 100% 4.950 3.465 N KALRN n/a
7 TRCN0000048210 CCTGTCCAAAGGATCACCAAA pLKO.1 4638 CDS 100% 4.950 3.465 N KALRN n/a
8 TRCN0000048212 GCATATCATCTTTGGCAACAT pLKO.1 4376 CDS 100% 4.950 3.465 N KALRN n/a
9 TRCN0000048209 GCCATGAACAACATGACCTTT pLKO.1 2856 CDS 100% 4.950 3.465 N KALRN n/a
10 TRCN0000001429 GTGGAGTTAATGTGCCTTGTT pLKO.1 6666 CDS 100% 4.950 3.465 N KALRN n/a
11 TRCN0000234367 GGACCTGGAGCTGGATATTAT pLKO_005 4136 CDS 100% 15.000 9.000 N KALRN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007431.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.